Blog

After elution and dialysis against phosphate-buffered saline (PBS), the protein was used for immunization of rabbits as described elsewhere [30]. Table 1 Oligonucleotides used in this study (911?bp) CgapA3 TACGaagcttACCTTAATTATTCAATTTTC HisC-f GATCCCTCGAGCCCGGGGCATGCCATCATCATCATCATCATTAATAGGGsynthetic 6xHis-tag HisC-r CGCCCTATTAATGATGATGATGATGATGGCATGCCCCGGGCTCGA ISL-f TATAccgcggATAAAGTCCGTATAATTGTGIS256L (1365?bp) ISL-r TATAccgcggATAAAGTCCGTATAATTGTG ISR-f TATAacgcgtGATAAAGTCCGTATAATTGTGIS256R (1342?bp) ISR-r ATTggcccgAAAATAATAAAGGAAGTGAGTC ISM-mgcF ATAAggatccTGTTGAAAAGCGCTTAGCMG gene was amplified using the LR-PCR system (Roche) and primers CgapA5 and CgapA3, introducing BL21 (DE3)pLys Star (Invitrogen). contains supplementary material, which is available to authorized users. Introduction Motility is regarded as a virulence factor in many pathogenic bacteria. The ability to move enables microorganisms to reach a specific niche or to leave hostile environments. Amongst motile bacteria, various mechanisms to create a momentum have evolved. In serovar Typhimurium flagellar motility has been shown to be crucial for the initial stages of contamination, while in motility is necessary to establish and maintain contamination [1]. In contrast to these species, in which motility can be downregulated SLC3A2 to favor a specific life-style, some bacteria, such as depend CNX-2006 on constitutive flagellar motility for successful contamination [1]. Experiments showing that only motile bacteria can be reisolated after contamination with a mixed populace of motile and non-motile variants underline the importance of motility in the infection process [2]. Mycoplasmas lack a cell wall and are considered to be the smallest self-replicating microorganisms. They have limited biosynthetic capabilities as CNX-2006 they are highly adapted to a parasitic life-style [3]. In spite of the many limitations that have resulted from their degenerative evolution, some mycoplasmas have the ability to travel over inert surfaces, like glass, plastic or over eukaryotic cells, even though they lack any obvious locomotory appendages such as flagella or pili [4]. is an avian pathogen causing chronic respiratory disease in chickens and infectious sinusitis in turkeys, that is known to possess gliding motility. Like the majority of gliding mycoplasmas, belongs to the cluster [5], named after the causative agent of human bronchitis and atypical pneumonia [6]. The mechanism that enables and other mycoplasmas to glide has been the subject of a number of studies [7]. The best studied gliding mechanism is usually that of isolated from the gills of a fresh-water fish [8], which is usually phylogenetically distant from the cluster. can be cultivated at room temperature and its average gliding velocity is usually 2 to 4.5?m/s [9], thus visualization of the gliding process is not dependent on additional microscope gear such as a plate heater or a computer-connected CCD video camera. Several proteins of have been identified as motility proteins [10]. Centered at the neck region of the jellyfish shape-like motility genes have been found in or cluster share a characteristic morphological feature, cellular polarity. These mycoplasmas have a flask-shaped appearance, strengthened by a cytoskeleton, and CNX-2006 have a differentiated tip structure, often called the attachment tip or terminal organelle (TO). In consists of a network of cytadherence proteins, including P1, P30, the accessory proteins P65, B, C, and the structural proteins HMW1, HMW2, and HMW3 [15]. Mutations affecting cytadherence or the correct assembly of the TO have direct effects on gliding motility. Loss of proteins P1, P30, or P65 lead to a nonmotile, as well as hemadsorption-negative, phenotype [16]. Similarly, mutations in the TO proteins P41 and P24 have an impact around the velocity and frequency of gliding [17]. Although several elements of the gliding machinery have been identified, it is still unclear how these motility-associated CNX-2006 proteins work in concert to generate a propulsive pressure and move the cell forward. Studies to elucidate the motility mechanisms of members of the pneumoniae cluster have also included a close relative of Their proteins share a high degree of homology [18]. Many of the proteins involved in motility have counterparts in [19]. Surprisingly, no protein involved in motility has yet been identified in was included in a CNX-2006 recent study of mycoplasma gliding [20], little is known about.