(E) Boyden Chamber assay analysis from the in vitro invasion capability of UMUC-3 and T24 cells stably expressing shCTL or shOGT. of suspected OGT cAMPS-Sp, triethylammonium salt glycosylation substrate was VCAN, S1PR3, PDGFRB, and PRKCG, the knockdown of which induced cell growth defects. These findings demonstrate the vital role of dysregulated OGT activity and hyper-O-GlcNAcylation in modulating treatment failure and tumor aggression in chemoresistant UCB. was constructed. The following shRNA sequences were used for the construct: forward, 5-CCGGCCAAACTTTCTGGATGCTTATCTCGAGATAAGCATCCAGAAAGTTTGGTTTT-3 and reverse, 5-AATTCAAAAACCAAACTTTCTGGATGCTTATCTCGAGATAAGCATCCAGAAAGTTTGG-3. Stable KD cells were generated using a lentiviral vector harboring either shOGT or scrambled shRNA as a control according to standard protocols for viral transduction. 2.4. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Total RNA was isolated using TRIzol (QIAGEN, Hilden, Germany), and cDNA was reverse transcribed from 1 g of RNA using SuperScript IV reverse transcriptase (18090050; Invitrogen). The qPCR was performed with SYBR Green using a real-time PCR LightCycler (Roche Diagnostics, Sydney, Australia). The relative amount of cDNA was calculated by the comparative Ct method using the 18S ribosomal RNA sequence as control. The primer sequences were as follows: (forward, CAGCATCCCAGCTCACTT and reverse, CAGCTTCACAGCTATGTCTTC); (forward, GATGCCGAGGAACTATTCATCT and reverse, TTTCTTCTCGTGCAGTGTCAC); (forward, GCCACTAGGTGTCCCCAA and reverse, GAGAATATCGGGCTCCGCTC); (forward, CACCCGCTAGGATGCCG and reverse, CTCCAGCGAGGGCGTTG); and (forward, GAGATAAGATGGGAAAGGCAGG and reverse, GGGGACAGTGAGGTGGAACA). 2.5. Western Blot (WB) Cells were harvested in ice-cold radioimmunoprecipitation assay lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% Na-deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and 1 mM EDTA) containing a protease-inhibitor cocktail (Roche Applied Bioscience, Basel, Switzerland) and a phosphatase inhibitor (Sigma-Aldrich, St. Louis, MO, USA). Soluble lysate fractions were isolated by centrifugation at 20,000 for 20 min at 4 C and quantified using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). Samples were resolved by SDS polyacrylamide gel electrophoresis using equal concentrations of protein and transferred to polyvinylidene fluoride membranes, which were blocked with 5% skim milk and then probed with the indicated primary and secondary antibodies according to standard protocols. Immunoblotted protein intensities were quantified using ImageJ software (NIH, Bethesda, MD, USA) and normalized to the loading control. 2.6. Antibodies and Reagents Primary antibodies against OGT Sox17 (24083) and O-GlcNAc (9875) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against -actin (A300C491A) were purchased from Bethyl Laboratories (Montgomery, TX, USA), and those against PRKCG (SC-166451) and PDGFRB (SC-374573) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Secondary antibodies against horseradish peroxidase-linked anti-rabbit (A120C101P) and anti-mouse (A90C116P) antibodies were purchased from Bethyl Laboratories. For immunohistochemistry (IHC), primary antibodies against OGT (ab96718) and Ki67 (ab15580) were purchased from cAMPS-Sp, triethylammonium salt Abcam (Cambridge, UK), and antibodies against Caspase-3 (9661) were purchased from Cell Signaling Technology. GEM (G6423) was purchased from Selleck Chemicals (Houston, TX, USA). PTX (T7402), Thiamet G (SML0244), MG132 (M7449), and phosphatase inhibitor cocktails 2 and 3 were purchased from Sigma-Aldrich. MTT (M1415) was purchased from Duchefa Biochemie (Haarlem, The Netherlands). Protease-inhibitor cocktail tablets were purchased from Roche cAMPS-Sp, triethylammonium salt Applied Biosciences, and RNAi-Max (13778150) was purchased from Thermo Fisher Scientific. 2.7. Cell Growth Assay To evaluate the cell growth rate, we performed a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Duchefa Biochemie). Cells were plated in 96-well plates for 24 h and incubated with the indicated doses of either chemotherapeutic drugs or a vehicle for an additional 72 h before harvest. Subsequently, MTT reagent (0.5 mg/mL) was added to each well and incubated for 6 h. Absorbance was measured according to manufacturer instructions, and cell growth was calculated as the ratio of the absorbance after reagent treatment to absorbance after vehicle treatment. 2.8. Cell Proliferation Assay Cell proliferation was measured using an image-based cell proliferation analyzer (IncuCyteTM; Essen Instruments, Ann Arbor, MI, USA). Cells were cultured in nutrient complete DMEM in multiwell plates overnight and imaged throughout the indicated time. An IncuCyte automated cell proliferation detector was used to measure cell proliferation through quantitative kinetic processing metrics derived from time-lapse image acquisition and presented as a percentage of cell confluence over time. 2.9. Wound.